Review

gdf5 (R&D Systems)

R&D Systems is a verified supplier

R&D Systems manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

R&D Systems gdf5

Figure 1. Identification of transcription factors predominantly expressed in articular cartilage cells. (A) Total RNA was isolated from SFZ, CC, LB, and C3H10T1/2 (10T1/2) cells. <t>Gdf5</t> and Prg4 expression was analyzed by RT-qPCR in triplicate. (B) Total RNA from SFZ cells and CC was analyzed by microarray. Genes with expression exceeding 100 in terms of the SFZ raw values were counted as genes expressed in SFZ cells. The number indicates the number of genes expressed more than two-fold in SFZ cells compared with the level in CC. The panel on the right shows 11 transcription factors among the genes with expression in SFZ cells more than two-fold that in CC. (C) Total RNA was isolated from SFZ, CC, LB, and 10T1/2 cells. Indicated gene expression was analyzed by RT-qPCR in triplicate. Data are the mean ± SEM.

Gdf5, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gdf5/product/R&D Systems
Average 92 stars, based on 8 article reviews

gdf5 - by Bioz Stars, 2026-03

92/100 stars

Images

1) Product Images from "HOXA10 promotes Gdf5 expression in articular chondrocytes."

Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes.

Journal: Scientific reports

doi: 10.1038/s41598-023-50318-7

Figure Legend Snippet: Figure 1. Identification of transcription factors predominantly expressed in articular cartilage cells. (A) Total RNA was isolated from SFZ, CC, LB, and C3H10T1/2 (10T1/2) cells. Gdf5 and Prg4 expression was analyzed by RT-qPCR in triplicate. (B) Total RNA from SFZ cells and CC was analyzed by microarray. Genes with expression exceeding 100 in terms of the SFZ raw values were counted as genes expressed in SFZ cells. The number indicates the number of genes expressed more than two-fold in SFZ cells compared with the level in CC. The panel on the right shows 11 transcription factors among the genes with expression in SFZ cells more than two-fold that in CC. (C) Total RNA was isolated from SFZ, CC, LB, and 10T1/2 cells. Indicated gene expression was analyzed by RT-qPCR in triplicate. Data are the mean ± SEM.

Techniques Used: Isolation, Expressing, Quantitative RT-PCR, Microarray, Gene Expression

Figure 2. Generation of Gdf5-HiBiT screening system. (A) Schematic diagram of Gdf5-HiBiT allele. The stop codon of Gdf5 and the knocked-in position of HiBiT tag are indicated. (B) Gdf5-HiBiT KI mice were generated using the Technique for Animal Knockout system by Electroporation (TAKE) method based on CRISPR/Cas9. Genomic DNA sequence analysis of the Gdf5 gene was performed, which confirmed that the genome of Gdf5- HiBiT KI allele had been edited correctly. Two possible off-target sites for the CRISPR gRNA (target sequence: TCGTGGAATCTTGTGGCTGC) are shown. Genomic DNA sequence analysis of two off-target sites was performed, which confirmed that the sequences around off-target sites were intact. (C) Genomic PCR analysis of WT and Gdf5-HiBiT KI mice was performed. A representative result is shown. The original gel is presented in Supplementary Fig. 1. (D) SFZ cells were isolated from WT and Gdf5-HiBiT KI mice. The cells were cultured for 2 days and then the supernatants were collected. DMEM, 10% FBS DMEM, and supernatants of WT and Gdf5-HiBiT KI SFZ cells were subjected to HiBiT measurement (n = 3). RLU: relative light unit. Data are the mean ± SEM (****: P < 0.0001).

Figure Legend Snippet: Figure 2. Generation of Gdf5-HiBiT screening system. (A) Schematic diagram of Gdf5-HiBiT allele. The stop codon of Gdf5 and the knocked-in position of HiBiT tag are indicated. (B) Gdf5-HiBiT KI mice were generated using the Technique for Animal Knockout system by Electroporation (TAKE) method based on CRISPR/Cas9. Genomic DNA sequence analysis of the Gdf5 gene was performed, which confirmed that the genome of Gdf5- HiBiT KI allele had been edited correctly. Two possible off-target sites for the CRISPR gRNA (target sequence: TCGTGGAATCTTGTGGCTGC) are shown. Genomic DNA sequence analysis of two off-target sites was performed, which confirmed that the sequences around off-target sites were intact. (C) Genomic PCR analysis of WT and Gdf5-HiBiT KI mice was performed. A representative result is shown. The original gel is presented in Supplementary Fig. 1. (D) SFZ cells were isolated from WT and Gdf5-HiBiT KI mice. The cells were cultured for 2 days and then the supernatants were collected. DMEM, 10% FBS DMEM, and supernatants of WT and Gdf5-HiBiT KI SFZ cells were subjected to HiBiT measurement (n = 3). RLU: relative light unit. Data are the mean ± SEM (****: P < 0.0001).

Techniques Used: Generated, Knock-Out, Electroporation, CRISPR, Sequencing, Isolation, Cell Culture

Figure 3. Role of HOXA10 in Gdf5 expression in articular cartilage cells. (A) SFZ cells isolated from WT mice were infected with empty (control) or indicated lentiviruses. Indicated gene expression was analyzed by RT-qPCR in duplicate. (B) Schematic diagram of Gdf5-HiBiT screening system. (C) SFZ cells were isolated from Gdf5-HiBiT KI mice and were plated on a 96-well plate. Gdf5-HiBiT KI SFZ cells were infected with the indicated lentiviruses. One day later, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. (D) SFZ cells isolated from WT mice were infected with empty (control) or FLAG-Hoxa10 lentiviruses. Hoxa10, Gdf5, and Prg4 expression was analyzed by RT-qPCR (n = 3). (E) SFZ cells isolated from WT mice were infected with empty (control), shHoxa10-1, or shHoxa10-2 lentiviruses. Hoxa10, Gdf5, and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).

Figure Legend Snippet: Figure 3. Role of HOXA10 in Gdf5 expression in articular cartilage cells. (A) SFZ cells isolated from WT mice were infected with empty (control) or indicated lentiviruses. Indicated gene expression was analyzed by RT-qPCR in duplicate. (B) Schematic diagram of Gdf5-HiBiT screening system. (C) SFZ cells were isolated from Gdf5-HiBiT KI mice and were plated on a 96-well plate. Gdf5-HiBiT KI SFZ cells were infected with the indicated lentiviruses. One day later, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. (D) SFZ cells isolated from WT mice were infected with empty (control) or FLAG-Hoxa10 lentiviruses. Hoxa10, Gdf5, and Prg4 expression was analyzed by RT-qPCR (n = 3). (E) SFZ cells isolated from WT mice were infected with empty (control), shHoxa10-1, or shHoxa10-2 lentiviruses. Hoxa10, Gdf5, and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).

Techniques Used: Expressing, Isolation, Infection, Control, Gene Expression, Quantitative RT-PCR, Cell Culture

Figure 5. Effect of HOXA10 on the Gdf5 gene promoter. (A) The ATAC-Seq database (articular chondrocytes: SRX13791211, costal chondrocytes: SRX11156876) from ChIP-Atlas was analyzed by integrative genomics viewer IGV2.8.6. A Gdf5 gene promoter (1393 bp) exhibits an open chromatin region on the Gdf5 gene in articular chondrocytes. (B) Schematic diagram of luciferase reporter construction with mouse Gdf5 gene promoter (− 1081 to + 312). A putative HOXA10 binding motif (− 538 to − 529) is shown with reference to previous study30. (C) HEK293T cells were transfected with empty or FLAG-Hoxa10 plasmids as well as luciferase reporter plasmids with mouse Gdf5 gene promoter. Cell lysates were subjected to luciferase measurement (n = 4). RLU: relative light unit. (D) SFZ cells isolated from WT mice were infected with empty (control) or FLAG-Hoxa10 lentiviruses. Gdf5 gene promoter fragments collected by ChIP using anti-FLAG antibody were analyzed by real-time qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).

Figure Legend Snippet: Figure 5. Effect of HOXA10 on the Gdf5 gene promoter. (A) The ATAC-Seq database (articular chondrocytes: SRX13791211, costal chondrocytes: SRX11156876) from ChIP-Atlas was analyzed by integrative genomics viewer IGV2.8.6. A Gdf5 gene promoter (1393 bp) exhibits an open chromatin region on the Gdf5 gene in articular chondrocytes. (B) Schematic diagram of luciferase reporter construction with mouse Gdf5 gene promoter (− 1081 to + 312). A putative HOXA10 binding motif (− 538 to − 529) is shown with reference to previous study30. (C) HEK293T cells were transfected with empty or FLAG-Hoxa10 plasmids as well as luciferase reporter plasmids with mouse Gdf5 gene promoter. Cell lysates were subjected to luciferase measurement (n = 4). RLU: relative light unit. (D) SFZ cells isolated from WT mice were infected with empty (control) or FLAG-Hoxa10 lentiviruses. Gdf5 gene promoter fragments collected by ChIP using anti-FLAG antibody were analyzed by real-time qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).

Techniques Used: Luciferase, Binding Assay, Transfection, Isolation, Infection, Control

Figure 4. Role of HOXA10 in Gdf5 expression in LB cells. (A) LB cells were isolated from Gdf5-HiBiT KI mice and plated on a 96-well plate. The cells were infected with empty (control), Venus, or FLAG-Hoxa10 lentiviruses. One day after infection, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. (B) LB cells isolated from WT mice were infected with empty (control), Venus, or FLAG-Hoxa10 lentiviruses. Hoxa10, Gdf5, and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, **: P < 0.01).

Figure Legend Snippet: Figure 4. Role of HOXA10 in Gdf5 expression in LB cells. (A) LB cells were isolated from Gdf5-HiBiT KI mice and plated on a 96-well plate. The cells were infected with empty (control), Venus, or FLAG-Hoxa10 lentiviruses. One day after infection, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. (B) LB cells isolated from WT mice were infected with empty (control), Venus, or FLAG-Hoxa10 lentiviruses. Hoxa10, Gdf5, and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, **: P < 0.01).

Techniques Used: Expressing, Isolation, Infection, Control, Cell Culture, Quantitative RT-PCR

Figure 6. Immunofluorescent analysis of HOXA10 and GDF5 in articular cartilage. Tibial sections from 3-month-old mice were subjected to co-immunostaining with anti-HOXA10 and anti-GDF5 antibodies. DAPI indicates nucleus. Scale bar, 50 μm.

Figure Legend Snippet: Figure 6. Immunofluorescent analysis of HOXA10 and GDF5 in articular cartilage. Tibial sections from 3-month-old mice were subjected to co-immunostaining with anti-HOXA10 and anti-GDF5 antibodies. DAPI indicates nucleus. Scale bar, 50 μm.

Techniques Used: Immunostaining

Image Search Results

Journal: Scientific reports

Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes.

doi: 10.1038/s41598-023-50318-7

Figure Lengend Snippet: Figure 1. Identification of transcription factors predominantly expressed in articular cartilage cells. (A) Total RNA was isolated from SFZ, CC, LB, and C3H10T1/2 (10T1/2) cells. Gdf5 and Prg4 expression was analyzed by RT-qPCR in triplicate. (B) Total RNA from SFZ cells and CC was analyzed by microarray. Genes with expression exceeding 100 in terms of the SFZ raw values were counted as genes expressed in SFZ cells. The number indicates the number of genes expressed more than two-fold in SFZ cells compared with the level in CC. The panel on the right shows 11 transcription factors among the genes with expression in SFZ cells more than two-fold that in CC. (C) Total RNA was isolated from SFZ, CC, LB, and 10T1/2 cells. Indicated gene expression was analyzed by RT-qPCR in triplicate. Data are the mean ± SEM.

Article Snippet: Slides were incubated overnight with primary antibodies against HOXA10 (GTX37412, GeneTex, Irvine, CA, USA; 1:100) and GDF5 (AF853, R&D Systems; 1:100).

Techniques: Isolation, Expressing, Quantitative RT-PCR, Microarray, Gene Expression

Journal: Scientific reports

Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes.

doi: 10.1038/s41598-023-50318-7

Figure Lengend Snippet: Figure 2. Generation of Gdf5-HiBiT screening system. (A) Schematic diagram of Gdf5-HiBiT allele. The stop codon of Gdf5 and the knocked-in position of HiBiT tag are indicated. (B) Gdf5-HiBiT KI mice were generated using the Technique for Animal Knockout system by Electroporation (TAKE) method based on CRISPR/Cas9. Genomic DNA sequence analysis of the Gdf5 gene was performed, which confirmed that the genome of Gdf5- HiBiT KI allele had been edited correctly. Two possible off-target sites for the CRISPR gRNA (target sequence: TCGTGGAATCTTGTGGCTGC) are shown. Genomic DNA sequence analysis of two off-target sites was performed, which confirmed that the sequences around off-target sites were intact. (C) Genomic PCR analysis of WT and Gdf5-HiBiT KI mice was performed. A representative result is shown. The original gel is presented in Supplementary Fig. 1. (D) SFZ cells were isolated from WT and Gdf5-HiBiT KI mice. The cells were cultured for 2 days and then the supernatants were collected. DMEM, 10% FBS DMEM, and supernatants of WT and Gdf5-HiBiT KI SFZ cells were subjected to HiBiT measurement (n = 3). RLU: relative light unit. Data are the mean ± SEM (****: P < 0.0001).

Article Snippet: Slides were incubated overnight with primary antibodies against HOXA10 (GTX37412, GeneTex, Irvine, CA, USA; 1:100) and GDF5 (AF853, R&D Systems; 1:100).

Techniques: Generated, Knock-Out, Electroporation, CRISPR, Sequencing, Isolation, Cell Culture

Journal: Scientific reports

Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes.

doi: 10.1038/s41598-023-50318-7

Figure Lengend Snippet: Figure 3. Role of HOXA10 in Gdf5 expression in articular cartilage cells. (A) SFZ cells isolated from WT mice were infected with empty (control) or indicated lentiviruses. Indicated gene expression was analyzed by RT-qPCR in duplicate. (B) Schematic diagram of Gdf5-HiBiT screening system. (C) SFZ cells were isolated from Gdf5-HiBiT KI mice and were plated on a 96-well plate. Gdf5-HiBiT KI SFZ cells were infected with the indicated lentiviruses. One day later, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. (D) SFZ cells isolated from WT mice were infected with empty (control) or FLAG-Hoxa10 lentiviruses. Hoxa10, Gdf5, and Prg4 expression was analyzed by RT-qPCR (n = 3). (E) SFZ cells isolated from WT mice were infected with empty (control), shHoxa10-1, or shHoxa10-2 lentiviruses. Hoxa10, Gdf5, and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).

Article Snippet: Slides were incubated overnight with primary antibodies against HOXA10 (GTX37412, GeneTex, Irvine, CA, USA; 1:100) and GDF5 (AF853, R&D Systems; 1:100).

Techniques: Expressing, Isolation, Infection, Control, Gene Expression, Quantitative RT-PCR, Cell Culture

Journal: Scientific reports

Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes.

doi: 10.1038/s41598-023-50318-7

Figure Lengend Snippet: Figure 5. Effect of HOXA10 on the Gdf5 gene promoter. (A) The ATAC-Seq database (articular chondrocytes: SRX13791211, costal chondrocytes: SRX11156876) from ChIP-Atlas was analyzed by integrative genomics viewer IGV2.8.6. A Gdf5 gene promoter (1393 bp) exhibits an open chromatin region on the Gdf5 gene in articular chondrocytes. (B) Schematic diagram of luciferase reporter construction with mouse Gdf5 gene promoter (− 1081 to + 312). A putative HOXA10 binding motif (− 538 to − 529) is shown with reference to previous study30. (C) HEK293T cells were transfected with empty or FLAG-Hoxa10 plasmids as well as luciferase reporter plasmids with mouse Gdf5 gene promoter. Cell lysates were subjected to luciferase measurement (n = 4). RLU: relative light unit. (D) SFZ cells isolated from WT mice were infected with empty (control) or FLAG-Hoxa10 lentiviruses. Gdf5 gene promoter fragments collected by ChIP using anti-FLAG antibody were analyzed by real-time qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).

Article Snippet: Slides were incubated overnight with primary antibodies against HOXA10 (GTX37412, GeneTex, Irvine, CA, USA; 1:100) and GDF5 (AF853, R&D Systems; 1:100).

Techniques: Luciferase, Binding Assay, Transfection, Isolation, Infection, Control

Journal: Scientific reports

Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes.

doi: 10.1038/s41598-023-50318-7

Figure Lengend Snippet: Figure 4. Role of HOXA10 in Gdf5 expression in LB cells. (A) LB cells were isolated from Gdf5-HiBiT KI mice and plated on a 96-well plate. The cells were infected with empty (control), Venus, or FLAG-Hoxa10 lentiviruses. One day after infection, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. (B) LB cells isolated from WT mice were infected with empty (control), Venus, or FLAG-Hoxa10 lentiviruses. Hoxa10, Gdf5, and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, **: P < 0.01).

Article Snippet: Slides were incubated overnight with primary antibodies against HOXA10 (GTX37412, GeneTex, Irvine, CA, USA; 1:100) and GDF5 (AF853, R&D Systems; 1:100).

Techniques: Expressing, Isolation, Infection, Control, Cell Culture, Quantitative RT-PCR

Journal: Scientific reports

Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes.

doi: 10.1038/s41598-023-50318-7

Figure Lengend Snippet: Figure 6. Immunofluorescent analysis of HOXA10 and GDF5 in articular cartilage. Tibial sections from 3-month-old mice were subjected to co-immunostaining with anti-HOXA10 and anti-GDF5 antibodies. DAPI indicates nucleus. Scale bar, 50 μm.

Article Snippet: Slides were incubated overnight with primary antibodies against HOXA10 (GTX37412, GeneTex, Irvine, CA, USA; 1:100) and GDF5 (AF853, R&D Systems; 1:100).

Techniques: Immunostaining

RegNPs were a metabolically active and mechanically sensitive population, while HomNPs were sensitive to hypoxia with “degenerative” potential. A) t‐SNE plots and representative violin plots showing the expression of Unc5c, Runx3, Bmp7, Wnt4, Tgfb2, CNTFR, Matn3, Grb10, Fgfr3, Epyc, Ptch1, and Pth1r on the t‐SNE map. B) Representation analysis of GO categories showing different functions for RegNPs. C) Heatmap revealing metabolic‐related functions and pathways for RegNPs. D) Representative images of lumbar spine sections from 4‐week‐old wild‐type mice stained for BMP7. Scale bars, 100 µm ( n = 3 mice per group). E) t‐SNE plots and representative violin plots showing the expression of Gdf5, Agt, Eln, Grem1, Mmp3, and Plau on the t‐SNE map. F) Representative analysis of GO categories showing different functions for HomNPs. G) Representative images of lumbar spine sections from 4‐week‐old WT mice stained for GDF5. The lower image shows a high‐magnification view of the indicated area from the upper image. Scale bars, 100 µm ( n = 3 mice per group).

Journal: Advanced Science

Article Title: Discovery and Application of Postnatal Nucleus Pulposus Progenitors Essential for Intervertebral Disc Homeostasis and Degeneration

doi: 10.1002/advs.202104888

Figure Lengend Snippet: RegNPs were a metabolically active and mechanically sensitive population, while HomNPs were sensitive to hypoxia with “degenerative” potential. A) t‐SNE plots and representative violin plots showing the expression of Unc5c, Runx3, Bmp7, Wnt4, Tgfb2, CNTFR, Matn3, Grb10, Fgfr3, Epyc, Ptch1, and Pth1r on the t‐SNE map. B) Representation analysis of GO categories showing different functions for RegNPs. C) Heatmap revealing metabolic‐related functions and pathways for RegNPs. D) Representative images of lumbar spine sections from 4‐week‐old wild‐type mice stained for BMP7. Scale bars, 100 µm ( n = 3 mice per group). E) t‐SNE plots and representative violin plots showing the expression of Gdf5, Agt, Eln, Grem1, Mmp3, and Plau on the t‐SNE map. F) Representative analysis of GO categories showing different functions for HomNPs. G) Representative images of lumbar spine sections from 4‐week‐old WT mice stained for GDF5. The lower image shows a high‐magnification view of the indicated area from the upper image. Scale bars, 100 µm ( n = 3 mice per group).

Article Snippet: Dissociated single cells were then stained with AF488 anti‐mouse UTS2R (R&D Systems, FAB9245G‐100UG), APC anti‐mouse GDF5 (ASSAYPRO, 32579‐05161), anti‐mouse CNTFRa (Santa Cruz Biotechnology, SC9993), BB700 anti‐mouse CD146 (BD Biosciences, 742 280), APC anti‐mouse CD44 (BioLegend, 559 250), BV421 anti‐mouse CD73 (BioLegend, 127 217), BV605 anti‐mouse CD90 (BioLegend, 140 317), APC anti‐mouse PDGFa/CD140a (BioLegend, 135 907), FITC anti‐mouse Sca‐1 (BioLegend, 108 106), PerCP/Cy5.5 anti‐CD31 (BioLegend, 102 420), PerCP/Cy5.5 anti‐CD45 (BioLegend, 103 132), PerCP/Cy5.5 anti‐mouse TER‐119 (BioLegend, 116 228), FITC anti‐mouse 6C3/Ly‐51 (BioLegend, 108 305), Brilliant Violet 605 anti‐mouse CD90.2 (BioLegend, 140 317), PE/Cy7 anti‐mouse CD105 (BioLegend, 120 409), APC anti‐mouse CD200 (BioLegend, 123 809), and anti‐mouse Alexa Fluor 488 (Molecular Probes, A21202, 1:1000).

Techniques: Metabolic Labelling, Expressing, Staining

Lineage tracing of UTS2R + NP cells. A) Dot plot showing the expression of Uts2r on the t‐SNE map. B) Representative immunofluorescence imaging of UTS2R (green) in postnatal 1‐month‐old WT mice. The right image shows high magnification of the indicated area from the left image ( n = 3 mice per group). Scale bars, 100 µm. C) Construction strategy of Uts2r‐CreER transgenic mice using the CRISPR/Cas9 System. D) Diagram showing postnatal day 1 (P1) Uts2r‐CreER;Ai9 /+ mice administered with one dosage tamoxifen and sacrificed at postnatal day 3 (P3), 1 month (P1M), or 2 months (P2M). E) Representative immunofluorescence imaging of Uts2r‐CreER;Ai9 + cells (red). The right images show high magnification of the indicated area from the left image ( n = 3 mice per group). Scale bars, 100 µm. F,G) Representative immunofluorescence imaging of Uts2r‐CreER;Ai9 + cells (red), BMP7 (green) (F) or GDF5 (green) (G). The right images show high magnification of the indicated area from the left image ( n = 3 mice per group). Scale bars, 100 µm.

Journal: Advanced Science

Article Title: Discovery and Application of Postnatal Nucleus Pulposus Progenitors Essential for Intervertebral Disc Homeostasis and Degeneration

doi: 10.1002/advs.202104888

Figure Lengend Snippet: Lineage tracing of UTS2R + NP cells. A) Dot plot showing the expression of Uts2r on the t‐SNE map. B) Representative immunofluorescence imaging of UTS2R (green) in postnatal 1‐month‐old WT mice. The right image shows high magnification of the indicated area from the left image ( n = 3 mice per group). Scale bars, 100 µm. C) Construction strategy of Uts2r‐CreER transgenic mice using the CRISPR/Cas9 System. D) Diagram showing postnatal day 1 (P1) Uts2r‐CreER;Ai9 /+ mice administered with one dosage tamoxifen and sacrificed at postnatal day 3 (P3), 1 month (P1M), or 2 months (P2M). E) Representative immunofluorescence imaging of Uts2r‐CreER;Ai9 + cells (red). The right images show high magnification of the indicated area from the left image ( n = 3 mice per group). Scale bars, 100 µm. F,G) Representative immunofluorescence imaging of Uts2r‐CreER;Ai9 + cells (red), BMP7 (green) (F) or GDF5 (green) (G). The right images show high magnification of the indicated area from the left image ( n = 3 mice per group). Scale bars, 100 µm.

Techniques: Expressing, Immunofluorescence, Imaging, Transgenic Assay, CRISPR

A 3D volume movie of a forelimb bud (E13.5) showing the Gdf5 (red) and Col2a1 (green) expression patterns. Nuclei are stained with DAPI (blue).

Journal: STAR Protocols

Article Title: Optimized protocol for whole-mount RNA fluorescent in situ hybridization using oxidation-mediated autofluorescence reduction on mouse embryos

doi: 10.1016/j.xpro.2023.102603

Figure Lengend Snippet: A 3D volume movie of a forelimb bud (E13.5) showing the Gdf5 (red) and Col2a1 (green) expression patterns. Nuclei are stained with DAPI (blue).

Article Snippet: Mouse Gdf5 HCR v3.0 probe set (B2) set size: 20 , Molecular Instruments , GenBank: NM_008109.4.

Techniques:

High signal-to-noise ratio and sensitive detection of multiple spatially distinct gene expression patterns in limb buds of different developmental stages (A–C) All limb buds shown in (A and B) are processed for and imaged by confocal microscopy without subsequent digital autofluorescence subtraction or masking. (A) Blood cell and blood vessel autofluorescence and probe penetration problems increase progressively with the more advanced stages of mouse limb bud development using a standard HCR RNA-FISH protocol (upper panels). In contrast, OMAR photobleaching in combination with SDS-detergent permeabilization reduces tissue autofluorescence improves probe penetration and signal-to-noise ratio at all stages analyzed (lower panels). (B) 3D reconstruction of the limb buds shown in the two rightmost images (lower panels in A) reveals the tissue integrity, even hybridization/signal detection, and very high signal-to-noise ratio throughout the limb buds. Scale bars: 300 μm. (C) Limb buds first analyzed by confocal microscopy (panels A and C) were remounted and imaged by light-sheet microscopy. Left panel: 3D volume rendering of a forelimb bud to detect both Msx1 (red channel) and Sox9 (green channel). Right panel: 3D volume rendering of a forelimb bud to detect Gdf5 (red) and Col2a1 (green). Nuclei are counterstained by DAPI (blue channel). and are available online for panel C. Scale bars: 500 μm.

Journal: STAR Protocols

Article Title: Optimized protocol for whole-mount RNA fluorescent in situ hybridization using oxidation-mediated autofluorescence reduction on mouse embryos

doi: 10.1016/j.xpro.2023.102603

Figure Lengend Snippet: High signal-to-noise ratio and sensitive detection of multiple spatially distinct gene expression patterns in limb buds of different developmental stages (A–C) All limb buds shown in (A and B) are processed for and imaged by confocal microscopy without subsequent digital autofluorescence subtraction or masking. (A) Blood cell and blood vessel autofluorescence and probe penetration problems increase progressively with the more advanced stages of mouse limb bud development using a standard HCR RNA-FISH protocol (upper panels). In contrast, OMAR photobleaching in combination with SDS-detergent permeabilization reduces tissue autofluorescence improves probe penetration and signal-to-noise ratio at all stages analyzed (lower panels). (B) 3D reconstruction of the limb buds shown in the two rightmost images (lower panels in A) reveals the tissue integrity, even hybridization/signal detection, and very high signal-to-noise ratio throughout the limb buds. Scale bars: 300 μm. (C) Limb buds first analyzed by confocal microscopy (panels A and C) were remounted and imaged by light-sheet microscopy. Left panel: 3D volume rendering of a forelimb bud to detect both Msx1 (red channel) and Sox9 (green channel). Right panel: 3D volume rendering of a forelimb bud to detect Gdf5 (red) and Col2a1 (green). Nuclei are counterstained by DAPI (blue channel). and are available online for panel C. Scale bars: 500 μm.

Article Snippet: Mouse Gdf5 HCR v3.0 probe set (B2) set size: 20 , Molecular Instruments , GenBank: NM_008109.4.

Techniques: Gene Expression, Confocal Microscopy, Hybridization, Microscopy

Journal: STAR Protocols

Article Title: Optimized protocol for whole-mount RNA fluorescent in situ hybridization using oxidation-mediated autofluorescence reduction on mouse embryos

doi: 10.1016/j.xpro.2023.102603

Figure Lengend Snippet:

Article Snippet: Mouse Gdf5 HCR v3.0 probe set (B2) set size: 20 , Molecular Instruments , GenBank: NM_008109.4.

Techniques: Recombinant, Hybridization, Amplification, Software, Microscopy, Imaging, Dissection

Review

Structured Review

Images

1) Product Images from "HOXA10 promotes Gdf5 expression in articular chondrocytes."

Similar Products

Image Search Results